NC 003540

   LOCUS       NC_003540                399 bp ss-RNA     circular VRL 08-DEC-2008
   DEFINITION  Chrysanthemum chlorotic mottle viroid, complete genome.
   ACCESSION   NC_003540
   VERSION     NC_003540.1  GI:20095240
   DBLINK      Project:14170
   KEYWORDS    virion.
   SOURCE      Chrysanthemum chlorotic mottle viroid
     ORGANISM  Chrysanthemum chlorotic mottle viroid
               Viroids; Avsunviroidae; Pelamoviroid.
   REFERENCE   1  (bases 1 to 399)
     AUTHORS   Navarro,B. and Flores,R.
     TITLE     Chrysanthemum chlorotic mottle viroid: unusual structural
               properties of a subgroup of self-cleaving viroids with hammerhead
               ribozymes
     JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 94 (21), 11262-11267 (1997)
      PUBMED   9326597
   REFERENCE   2  (bases 1 to 399)
     CONSRTM   NCBI Genome Project
     TITLE     Direct Submission
     JOURNAL   Submitted (17-MAY-2002) National Center for Biotechnology
               Information, NIH, Bethesda, MD 20894, USA
   REFERENCE   3  (bases 1 to 399)
     AUTHORS   Flores,R.
     TITLE     Direct Submission
     JOURNAL   Submitted (27-AUG-1997) R. Flores, Instituto de Biologia Molecular
               y Celul. de Plantas, (UPV-CSIC), Universidad Politecnica de
               Valencia, Camino de Vera 14, 46022 Valencia, SPAIN
   COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
               reference sequence was derived from Y14700.
               COMPLETENESS: full length.
   FEATURES             Location/Qualifiers
        source          1..399
                        /organism="Chrysanthemum chlorotic mottle viroid"
                        /mol_type="genomic RNA"
                        /cultivar="Bonnie Jean"
                        /isolate="Horst"
                        /db_xref="taxon:68402"
        variation       5
                        /note="variant CM1"
                        /replace="t"
        variation       10
                        /note="variant CM20"
                        /replace="t"
        variation       34
                        /note="variant CM1"
                        /replace="a"
        variation       70
                        /note="variant CM20"
                        /replace="c"
        variation       141..142
                        /note="variant CM20"
                        /replace="aa"
        variation       141
                        /note="variant CM1"
                        /replace=""
        variation       184
                        /note="variant CM1"
                        /replace="c"
        variation       204
                        /note="variant CM1"
                        /replace="g"
        variation       216
                        /note="variant CM1"
                        /replace="t"
        variation       224
                        /note="variant CM1"
                        /replace="a"
        variation       260
                        /note="variant CM1"
                        /replace="t"
        variation       383..384
                        /note="variant CM1"
                        /replace="at"
   ORIGIN      
           1 ggcacctgac gtcggtgtcc tgatgaagat ccatgacagg atcgaaacct cttccagttt
          61 cggcttgtgt gggagtaaag ctttcgctct ctccacagcc tcatcaggaa acccacttca
         121 ggtctcgact ggaaggtcgt taaacttccc ctctaagcgg agtagaggta aatacctccg
         181 tccaaccccg ggaggaaagg ggttgggacc cggaacagat ccagttccgg tcctttggag
         241 tccatttctc tcgttggata ttctcctcgg agaagggaga tggggccagt cccagtcggt
         301 tcgctctcgt agtcacagcc actggggaac ctaggcagat ggctggacgg agtcttagtc
         361 cactccagag gaccttgggt ttgaaacccc caagaggtc
   //

Вторичная структура

Связи

GGGAGACCUGAAGUGGGUUUCCC

12345678901234567890123

• 1-23
• 2-22
• 3-21
• 4-20
• 5-19
• 6-18
• 7-17
• 8-16

aagaggucggcaccugacgucgguguccugaugaagauccaugacaggaucgaaaccucuu

Третичная структура

См. также

• PDB